Czapeczka 5' i ogon poly-A. Splicing (składanie), introny i exony. Tłumaczenie na język polski zrealizowane przez Fundację Edukacja dla Przyszłości dzięki wsparciu Fundacji „HASCO-LEK".

Kluczowe punkty:

  • Kiedy transkrypt RNA jest tworzony w komórkach eukariotycznych, uważa się go za pre-mRNA i musi on ulec obróbce, aby stać się informacyjnym RNA (mRNA).
  • Czapeczka jest dodawana do początku transkryptu RNA (5') i ogon poli-A jest dodawany na końcu (3').
  • Podczas splicingu (składania), niektóre regiony w transkrypcie RNA (introny) są usuwane i pozostające fragmenty (eksony) są ze sobą sklejane.
  • Niektóre geny mogą być alternatywnie składane, prowadząc do wytworzenia różnych dojrzałych cząsteczek mRNA z tego samego początkowego transkryptu.

Wstęp

Wyobraź sobie, że prowadzisz fabrykę produkującą książki i dopiero co wydrukowałeś wszystkie strony swojej ulubionej książki. Teraz, kiedy masz jej strony, czy książka jest gotowa do czytania? No cóż... książki zwykle mają okładki z przodu i z tyłu, więc możesz chcieć je dołożyć. Także, czy są puste lub zepsute strony podczas druku? Prawdopodobnie powinieneś to sprawdzić i usunąć je zanim sprzedasz swoje książki lub możesz skończyć z kilkoma niezadowolonymi klientami.
Etapy, o których dopiero co mówiliśmy są dość podobne tego, co dzieje się z transkryptami RNA w naszym ciele. U ludzi i innych eukariotów, świeżo utworzone transkrypty RNA (z ostatniej chwili z polimerazy RNA) nie są całkiem gotowe do pracy. Natomiast nazywane są pre-mRNA i muszą przechodzić przez niektóre etapy obróbki, aby stać się dojrzałymi informacyjnymi RNA (mRNA, ang. messenger RNA), które mogą zostać przepisane na białko. Obejmuje to:
  • Dodanie cząsteczek czapeczki i ogona do dwóch końców transkryptu. Odkrywają one ochronną rolę, tak jak okładki książki.
  • Usunięcie sekwencji "śmieciowych" nazywanych intronami. Introny są czymś w rodzaju pustych lub zniszczonych stron tworzonych podczas druku książki, które muszą zostać usunięte, aby mogła być czytelna.
W tym artykule, przyjrzymy się bliżej czapeczce, ogonowi i modyfikacjom splicingowym, które dotyczą eukariotycznych transkryptów RNA. Będziemy obserwować jak zachodzą i dlaczego są ważne dla upewnienia się, że otrzymamy prawidłowe białko z naszego RNA.

Krótkie omówienie obróbki pre-mRNA u eukariotów

Szybkie powtórzenie - ekspresja genów ("odczytywanie" genu, aby mogło powstać białko lub kawałek białka) zachodzi trochę inaczej u bakterii i eukariotów, takich jak ludzie.
Lewy panel: komórka eukariotyczna. W jądrze komórkowym, pre-mRNA jest wytwarzane dzięki transkrypcji fragmentu DNA liniowego chromosomu. Ten transkrypt musi przejść obróbkę (splicing i dodanie czapeczki i ogona poli-A), kiedy nadal jest w jądrze, aby stać się dojrzałym mRNA. Dojrzałe mRNA jest eksportowane z jądra do cytozolu, gdzie jest przepisywane przez rybosom, aby utworzyć polipeptyd.
Prawy panel: bakteria. DNA przyjmuje kształt kolistego chromosomu i jest zlokalizowany w cytozolu. Kiedy DNA ulega transkrypcji, aby utworzyć RNA, RNA (które już w tym punkcie uważane jest za mRNA) może łączyć się z rybosomem i rozpocząć translację, aby syntetyzować białko.
U bakterii, transkrypty RNA są natychmiast gotowe do działania jako informacyjne RNA i ulegania translacji do białek. U eukariotów, kwestie te są bardziej złożone, chociaż w całkiem interesujący sposób. Cząsteczka, która bezpośrednio ulega transkrypcji w jednej z Twoich (eukariotycznych) komórek jest nazywana pre-mRNA, odzwierciedlając fakt, że potrzebuje przejść kilka dodatkowych etapów, aby stać się rzeczywistym informacyjnym RNA (mRNA). Są to:
  • Dodanie czapeczki na początku RNA (5')
  • Dodanie ogona poli-A (ogona z nukleotydów A) na końcu RNA
  • Wycięcie intronów, czyli "śmieciowych" sekwencji i ponowne sklejanie pozostających, dobrych sekwencji (eksonów)
Po zakończeniu tych etapów, RNA jest dojrzałym mRNA. Może podróżować poza jądro i być używane do utworzenia białka.

Czapeczka i ogon poli-A

Oba końce pre-mRNA są zmieniane poprzez dodanie grup chemicznych. Grupa na początku (koniec 5') jest nazywana czapeczką, kiedy grupa na końcu (koniec 3') jest nazywana ogonem. I czapeczka i ogon ochraniają transkrypt i pomagają w jego eksporcie z jądra i translacji przez rybosomy ("urządzenia" wytwarzające białka) znajdujące się w cytozolustart superscript, 1, end superscript.
Czapeczka jest dodawana do pierwszego nukleotydu w transkrypcie podczas transkrypcji. Czapeczka to zmodyfikowana guanina (G), która chroni transkrypt przed zniszczeniem. Także pomaga rybosomowi przyłączyć się do mRNA i rozpocząć tworzenie białka.
Obraz przedstawiający pre-mRNA z czapeczką i ogonem poli-A. Czapeczka jest na końcu 5' pre-mRNA i jest zmodyfikowaną guaniną. Ogon poli-A jest na końcu 3' pre-mRNA i składa się z długiego łańcucha nukleotydów A (pokazano tylko kilka z nich).
Jak dodawany jest ogon poli-A? Koniec 3' RNA tworzy rodzaj dziwacznej drogi. Kiedy sekwencja nazywana sygnałem poliadenylacji pojawia się w cząsteczce RNA podczas transkrypcji, enzym w tym miejscu tnie RNA na dwie części. Inny enzym dodaje około 100 200 adenin (A) na obciętym końcu tworząc ogon poli-A. Ogon sprawia, że transkrypt jest bardziej stabilny i pomaga w jego eksporcie do cytozolu.

Splicing RNA

Trzecią ważną obróbką RNA dziejącą się w Twoich komórkach jest splicing RNA. W splicingu RNA, specyficzne części pre-mRNA, nazywane intronami są organizowane i usuwane przez kompleks białek z RNA nazywany spliceosomem. Introny mogą być postrzegane jako "śmieciowe" sekwencje, które muszą zostać wycięte, aby "dobre części" cząsteczki RNA mogły być złożone.
Jakie są te dobre "dobre części"? Kawałki RNA, które nie są wycinane, nazywane są eksonami. Eksony są sklejane razem przez spliceosom, aby utworzyć ostateczne, dojrzałe mRNA, które jest wysyłane poza jądro.
Schemat pre-mRNA pokazujący eksony i introny. Wzdłuż długości mRNA, jest zmieniający się wzór eksonów i intronów: ekson 1 - intron 1 - ekson 2 - intron 2 - ekson 3. Każdy zawiera odcinek nukleotydów RNA. Podczas splicingu, introny są usuwane z pre-mRNA i eksony są razem łączone, aby utworzyć dojrzałe mRNA, które nie zawiera sekwencji intronowych.
Tutaj najważniejszy jest fakt, że tylko eksony genu, kodują białko. Nie tylko introny nie kodują informacji do budowy białka, w rzeczywistości muszą być usunięte, aby mRNA kodowało białko o prawidłowej sekwencji. Jeśli spliceosom nie usunie intronów, będzie utworzony mRNA z dodatkowymi "śmieciami" i będzie syntetyzowane nieprawidłowe białko podczas translacji.
Splicing wymaga precyzji i spójności. To dokładne cięcie i łączenie jest przeprowadzane przez spliceosom, kompleks enzymatyczny zbudowany z białek i małych RNA. Większość intronów zawiera sekwencje markerowe na obu swoich końcach, które są rozpoznawane przez małe RNA i bezpośrednio przez spliceosom, aby usunąć intron. Kiedy intron zostaje wycięty, spliceosom "skleja" (przeprowadza ligację) razem otaczające go eksony.

Alternatywny splicing

Dlaczego składanie? Nie wiemy na pewno, dlaczego istnieje splicing i w pewien sposób wydaje się być on rozrzutnym systemem. Jednakże, splicing pozwala na proces nazywany alternatywnym splicingiem, w którym może być tworzone więcej niż jedno mRNA z tego samego genu. Dzięki alternatywnemu splicingowi, my (i inne eukarioty) możemy podstępnie kodować więcej różnych białek niż mamy genów w naszym DNA.
W alternatywnym splicingu, jedno pre-mRNA może być składane na dwa (lub czasami wiele więcej niż dwa!) różne sposoby. Na przykład, na poniższym schemacie, takie samo pre-mRNA może być składane na trzy różne sposoby, w zależności od eksonu. To skutkuje trzema różnymi dojrzałymi mRNA, każdy z nich ulega translacji do białka o różnej strukturze.
Schemat alternatywnego splicingu
Sekwencja DNA genu koduje transkrypt pre-mRNA, który zawiera pięć regionów, które mogą potencjalnie być wykorzystywane jako eksony: ekson 1, ekson 2, ekson 3, ekson 4, ekson 5. Eksony są ułożone w sposób liniowy wzdłuż pre-mRNA i posiadają pomiędzy sobą introny.
Podczas splicingu #1, wszystkie pięć eksonów jest zachowane w dojrzałym mRNA. Zawiera ekson 1 - ekson 2 - ekson 3 - ekson 4 - ekson 5. Kiedy ulega translacji, definiuje białko A, białko z pięcioma domenami: helisa 1 (określana przez ekson 1), helisa 2 (określana przez ekson 2), pętla 3 (określana przez ekson 3), pętla 4 (określana przez ekson 4), i helisa 5 (określana przez ekson 5).
Podczas splicingu #2, ekson 3 nie zawiera dojrzałego mRNA. Zawiera: ekson 1 - ekson 2 - ekson 4 - ekson 5. Kiedy ulega translacji, definiuje białko B, białko o sześciu domenach: helisa 1 (określana przez ekson 1), helisa 2 (określana przez ekson 2), pętla 4 (określana przez ekson 4), i pętla 5 (określana przez ekson 5). Białko nie zawiera pętli 3, ponieważ ekson 3 nie jest obecny w mRNA.
Podczas splicingu 3, ekson 4 nie jest obecny w dojrzałym mRNA. Zawiera ekson 1 - ekson 2 - ekson 3 - ekson 5. Kiedy ulega translacji, definiuje białko C, białko o czterech domenach: helisa 1 (określana przez ekson 1), helisa 2 (określana przez ekson 2), pętla 3 (określana przez ekson 3), i pętla 5 (określana przez ekson 5). Nie zawiera pętli 4, ponieważ ekson 4 nie jest obecny w mRNA.
Obraz za: "DNA, alternative splicing," the National Human Genome Research Institute (domena publiczna).
Dobre pytanie! Zawodowi biologowie także chcieliby znać odpowiedź. Nie jest całkowicie jasne, dlaczego introny i splicing są tak rozpowszechnione u eukariotów.
Jedna możliwość jest taka, że generalnie splicing umożliwia alternatywny splicing, który zdaje się być ważny dla eukariotów (dzięki pozwoleniu im na utworzenie więcej różnych białek z pojedynczego genu). Także czasami introny zawierają sekwencje regulatorowe, które kontrolują ekspresję genu (nie są w rzeczywistości "śmieciowe")start superscript, 2, end superscript. Czasami małe RNA, które regulują ekspresję genów, pochodzą z intronów, które zostały wycięte start superscript, 3, end superscript. Także obecność eksonów i intronów ułatwia nowym genom i allelom tworzenie mutacji, które mieszają i łączą fragmenty genów, które byłyby zaletami w toku ewolucjistart superscript, 2, comma, 4, end superscript.

Spróbuj sam: Ułóż wiadomość

Podejmij wyzwanie: odszyfruj poniższą tajną wiadomość. Na początku usuń "śmieciowe" litery, w kolorze fioletowym i podkreślone. Po drugie, zgrupuj litery w trójki zaczynając od początku.
start color maroonD, M, A, M, P, S, Y, A, end color maroonDAMAPQ\purpleC{\underline{\text{AMAPQ}}}start color maroonD, L, E, K, O, T, B, end color maroonDZAPTQM\purpleC{\underline{\text{ZAPTQM}}}
Spróbowałeś już?
  • Jeśli usuniesz fioletowe sekwencje, otrzymasz te zestawy liter:
    start color maroonD, M, A, M, P, S, Y, A, end color maroonDstart color maroonD, L, E, K, O, T, B, end color maroonD
  • Jeśli zgrupujesz pozostałe litery w zestawy trójek, otrzymasz tą wiadomość:
    start color maroonD, M, A, M, space, P, S, Y, space, A, end color maroonDstart color maroonD, L, E, space, K, O, T, space, B, end color maroonD
    Okay, może nie jest to najbardziej tajemnicza wiadomość na świecie. Mam nadzieję, że udało Wam się rozwiązać to zadanie.
Proces, który dopiero co chciałeś przeprowadzić, jest w zasadzie tym, co muszą robić Twoje komórki, kiedy wykonują ekspresję genu. Jak mówiliśmy wcześniej, większość eukariotycznych pre-mRNA zawiera introny, które są jak fioletowe litery w wiadomości. Te sekwencje muszą zostać usunięte i znaczące sekwencje (eksony), odpowiadające fioletowym literom w powyższej wiadomości, muszą zostać razem połączone, aby utworzyć dojrzałe mRNA.
Podczas translacji, sekwencja mRNA jest odczytywana trójkami nukleotydów. Każde trzyliterowe "słowo" odpowiada aminokwasowi, który jest dodawany do polipeptydu (białka lub jego podjednostki). Jeśli RNA nie ulegnie splicingowi, będzie zawierać dodatkowe nukleotydy, których nie powinien, prowadząc do nieprawidłowej białkowej "wiadomości". Coś podobnego dzieje się, jeśli próbujemy odszyfrować powyższą wiadomość bez usuwania fioletowych liter:
start color maroonD, M, A, M, space, P, S, Y, space, A, end color maroonDAM APQ\purpleC{\underline{\text{AM APQ}}}start color maroonD, space, L, E, K, space, O, T, B, end color maroonD ZAP TQM \purpleC{\underline{\text{ ZAP TQM }}}
Podobnie jak usuwanie fioletowych liter ze zdania jest kluczowe w uzyskaniu prawidłowej wiadomości, tak splicing jest kluczowy dla zapewnienia, że mRNA niesie prawidłową informację (i kieruje wytwarzaniem prawidłowego polipeptydu).
Tutaj znajduje się sekwencja pre-mRNA, z eksonami z pogrubionych, czerwonych liter i jednym intronem z podkreślonych fioletowych liter.
5, apostrophe, negative, point, point, point, start color maroonD, A, U, G, C, A, C, U, A, U, end color maroonDGUAUGUGCCUUUUUGUGCUGUG\purpleC{\underline{\text{GUAUGUGCCUUUUUGUGCUGUG}}}start color maroonD, G, A, A, G, C, G, U, A, A, end color maroonD, point, point, point, negative, 3, apostrophe
Jeśli pre-mRNA prawidłowo ulegnie splicingowi, nukleotydy dojrzałego mRNA są odczytywane trójkami, wytwarzając polipeptyd pokazany poniżej:
5, apostrophe, negative, point, point, point, start color maroonD, A, U, G, space, C, A, C, space, U, A, U, space, end color maroonDstart color maroonD, G, A, A, space, G, C, G, space, U, A, A, end color maroonD, point, point, point, negative, 3, apostrophe
M, e, t, space, negative, space, H, i, s, space, negative, space, T, y, r, space, negative, space, G, l, u, space, negative, space, A, l, a, space, negative, space, S, T, O, P
Jeśli intron nie zostanie usunięty z pre-mRNA, powstający nieprawidłowy mRNA zawiera dodatkowe nukleotydy. Kiedy jego nukleotydy są odczytywane trójkami, jak pokazano poniżej, wytwarzany jest polipeptyd z nieprawidłową sekwencją aminokwasową. Jest zbyt wiele aminokwasów i aminokwasy definiowane przez drugi ekson nie są syntetyzowane (ponieważ przesunięta jest ramka odczytu):
5, apostrophe, negative, point, point, point, start color maroonD, A, U, G, space, C, A, C, space, U, A, U, space, end color maroonDGUA UGU GCC UUU UUG UGC UGU G\purpleC{\underline{\text{GUA UGU GCC UUU UUG UGC UGU G}}}start color maroonD, G, A, space, A, G, C, space, G, U, A, space, A, end color maroonD, point, point, point, negative, 3, apostrophe
M, e, t, space, negative, space, H, i, s, space, negative, space, T, y, r, space, negative, space, V, a, l, space, negative, space, C, y, s, space, negative, space, A, l, a, space, negative, space, P, h, e, space, negative, space, L, e, u, space, negative, space, C, y, s, space, negative, space, C, y, s, space, negative, space, G, l, y, space, negative, space, S, e, r, space, negative, space, V, a, l, space, point, point, point
Wszystkie powyższe związki pomiędzy grupami nukleotydów i aminokwasów, które kodują, mogą być determinowane wykorzystując tabelę kodu genetycznego
Image credit: "The genetic code: Figure 3," by OpenStax College, Biology (CC BY 3.0).
Sekwencja intronu zmodyfikowana z Bourdin et al.start superscript, 4, end superscript.
Zmodyfikowany artykuł może być używany zgodnie z licencją CC BY-NC-SA 4.0.

Cytowane prace:

  1. Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V., Jackson, R. B. (2011). Alteration of mRNA ends. W Campbell biology (10th ed., p. 342-343). San Francisco, CA: Pearson.
  2. Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V., Jackson, R. B. (2011). The first single-celled organisms. W Campbell biology (edycja 10, str. 526). San Francisco, CA: Pearson.
  3. Keren, H., Lev-Maor, G., Ast, G. (2010). Alternative splicing and evolution: diversification, exon definition and function. Nature Reviews Genetics, 11, 345-355. http://dx.doi.org/10.1038/nrg2776. Źródło: https://www.tau.ac.il/~gilast/PAPERS/nrg2776.pdf.
  4. Standage, D. (8 kwietnia 2012). Why do eukaryotic organisms have introns in their DNA? [odpowiedź] W Biology stack exchange. Źródło: http://biology.stackexchange.com/questions/1724/why-do-eukaryotic-organisms-have-introns-in-their-dna.
  5. Bourdin, C. M., Moignot, B., Wang, L., Murillo, L., Juchaux, M., Quinchard, S., Lapied, B., Guérineau, N. C., Dong, K., Legros, C. (2013). Intron retention in mRNA encoding ancillary subunit of insect voltage-gated sodium channel modulates channel expression, gating regulation and drug sensitivity. PLoS ONE, 8(8), e67290. http://dx.doi.org/10.1371/journal.pone.0067290.

Dodatkowe źródła

3'-end cleavage and polyadenylation. (2016). Na Nobelprize.org. Źródło: http://www.nobelprize.org/educational/medicine/dna/a/splicing/splicing_endformation.html.
Alberts, B., Johnson, A., Lewis, J., Raff, M., Roberts, K., Walter, P. (2002). Posttranscriptional controls. W Molecular biology of the cell (4th ed.). New York, NY: Garland Science. Źródło: http://www.ncbi.nlm.nih.gov/books/NBK26890/.
Intron/introns. (2014). W Scitable. Źródło: http://www.nature.com/scitable/definition/intron-introns-67.
Lodish, H., Berk, A., Zipursky, S. L., Matsudaira, P., Baltimore, D., Darnell, J. (2000). Processing of eukaryotic mRNA. W Molecular cell biology (4th ed., section 11.2). New York, NY: W. H. Freeman. Źródło: http://www.ncbi.nlm.nih.gov/books/NBK21563/.
Lodish, H., Berk, A., Zipursky, S. L., Matsudaira, P., Baltimore, D., Darnell, J. (2000). Transcription termination. W Molecular cell biology (4th ed., section 11.1). New York, NY: W. H. Freeman. Źródło: http://www.ncbi.nlm.nih.gov/books/NBK21601/.
Polyadenylation. (24 stycznia 2016). Dostęp 11 lutego 2016 do Wikipedia: https://en.wikipedia.org/wiki/Polyadenylation.
Raven, P. H., Johnson, G. B., Mason, K. A., Losos, J. B., Singer, S. R. (2014). Genes and how they work. W Biology (10th ed., AP ed., pp. 278-303). New York, NY: McGraw-Hill.
Reece, J. B., Urry, L. A., Cain, M. L., Wasserman, S. A., Minorsky, P. V., Jackson, R. B. (2011). Eukaryotic cells modify RNA after transcription. W Campbell biology (10th ed., p. 342-345). San Francisco, CA: Pearson.